View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_80 (Length: 230)
Name: NF18704_low_80
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_80 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 13 - 119
Target Start/End: Original strand, 24192604 - 24192705
Alignment:
| Q |
13 |
cagagattgaaatggtgccttccttctctcaaacatgtcaaatggttctctcatattttgtgtgaagagcgtcgaagatggttggacgcacaagtaactc |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24192604 |
cagagattgaaatggtaccttccttctctcaaacatgt-----ggttctctcatattttgtgtgaagagcgtcgaagatggttggacgcacaagtaactc |
24192698 |
T |
 |
| Q |
113 |
tgatgga |
119 |
Q |
| |
|
||||||| |
|
|
| T |
24192699 |
tgatgga |
24192705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 13 - 119
Target Start/End: Original strand, 24200712 - 24200817
Alignment:
| Q |
13 |
cagagattgaaatggtgccttccttctctcaaacatgtcaaatggttctctcatattttgtgtgaagagcgtcgaagatggttggacgcacaagtaactc |
112 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24200712 |
cagagattgaaatggcccctcccttctctcatacatgtcaaatggttctctcatattt-gtgtgacgagcgtcgaagatggttggacgcacaagtaactc |
24200810 |
T |
 |
| Q |
113 |
tgatgga |
119 |
Q |
| |
|
||||||| |
|
|
| T |
24200811 |
tgatgga |
24200817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University