View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18704_low_85 (Length: 221)
Name: NF18704_low_85
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18704_low_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 7 - 204
Target Start/End: Complemental strand, 39758715 - 39758518
Alignment:
| Q |
7 |
agaagcaaaggacacaaagagtcagttcaggctcgacctttggtgaatgagactttgcgacaactcgaggccgcggaaagaactatagagttgtcatgaa |
106 |
Q |
| |
|
|||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39758715 |
agaatcaacggacgcaaagagtcagttcaggctcgacctttggtgaatgagactttgcgacaactcgaggccgcggaaagaactatagagttgtcatgaa |
39758616 |
T |
 |
| Q |
107 |
ccaatgctggaaaagccgtgcaaagatacaactcctccgctttagactcaaaccattctagaacacacgcgaaatcgagccgtgcacatgatagtaat |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39758615 |
ccaatgctggaaaatccgtgcaaagatacaactcctccgctttagactcaaaccattctagaacacacgcgaaatcgagccgtgcacatgatggtaat |
39758518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 90
Target Start/End: Complemental strand, 39764401 - 39764332
Alignment:
| Q |
21 |
caaagagtcagttcaggctcgacctttggtgaatgagactttgcgacaactcgaggccgcggaaagaact |
90 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| ||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
39764401 |
caaagagtcaaatcaggctcaacctttggtgaacgagactttgcgacaacttgaggcagcgaaaagaact |
39764332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University