View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18704_low_87 (Length: 208)

Name: NF18704_low_87
Description: NF18704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18704_low_87
NF18704_low_87
[»] chr2 (2 HSPs)
chr2 (68-191)||(41785155-41785277)
chr2 (21-78)||(41785339-41785396)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 68 - 191
Target Start/End: Complemental strand, 41785277 - 41785155
Alignment:
68 atatttctaaattcaatatatcgatcctccaatttaaatgtttattttattcttgtatattttgaggctatatttttgataatataacaattgaaatgtt 167  Q
    |||| |||||||| ||||||| | ||||||||||| ||||||||||||| |||||| |||||||||| |||| ||||||||||||||||||||| |||||    
41785277 atatctctaaatttaatatattggtcctccaatttgaatgtttattttactcttgtgtattttgaggttata-ttttgataatataacaattgagatgtt 41785179  T
168 tatgtgacaacttaatcgatcaca 191  Q
    |||||||||||||| |||||||||    
41785178 tatgtgacaacttagtcgatcaca 41785155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 41785396 - 41785339
Alignment:
21 gtggatgattgattagtgaaccttaatgaagcataatactattaagaatatttctaaa 78  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41785396 gtggatgattgattagtgaaccttaatgaagcataatactattaagaatatttctaaa 41785339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University