View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18705_low_13 (Length: 297)
Name: NF18705_low_13
Description: NF18705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18705_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 9 - 204
Target Start/End: Original strand, 36929346 - 36929541
Alignment:
| Q |
9 |
agcacagatcaatgtgagaaagatagatttgtgattaatttgagttttaaaaatattatcagagtagcctcaaatctgacattcaatatcttcttgggag |
108 |
Q |
| |
|
||||||||||||||||| |||| | ||||| |||| || | |||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36929346 |
agcacagatcaatgtgacaaaggtggatttatgataaagtggagtttggaaaatattatcagagtagcctcaaatctgacattcaatatcttcttggtag |
36929445 |
T |
|
| Q |
109 |
gtaatccaattacctgtaacatttgggttatctgcactgggattgtttctccagcttcatgctacaaatgagtgataagttttagaatttacttcc |
204 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| ||| |||| |||| || ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36929446 |
gtaatccaattacctgtaacattttggagatctgcaatggaattgcttcttcacctttatgctacaaatgagtgataagttttagaatttacttcc |
36929541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 217 - 278
Target Start/End: Original strand, 36929524 - 36929585
Alignment:
| Q |
217 |
gttttagaatttccttcccatggttttaattagttgattttaatgagctgttaccaataatt |
278 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
36929524 |
gttttagaatttacttcccatggttttatttagttgattttaatgagttgttaccaataatt |
36929585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University