View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18705_low_8 (Length: 438)
Name: NF18705_low_8
Description: NF18705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18705_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 8e-65; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 264 - 429
Target Start/End: Complemental strand, 41184297 - 41184132
Alignment:
| Q |
264 |
gatacgggtagaaaatatagtcaattaaaactccatttaaaattaaaattgacattatttttgagannnnnnnngttataaatatagcggctatgaaaca |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
41184297 |
gatacgggtagaaaatatagtcaattaaaactccatttaaaattaaaattgacattatttttgagattctttttgttataaatataacggctatgaaaca |
41184198 |
T |
|
| Q |
364 |
taggaagtaatcattttcttatacaaacacaaattatgtttcacctcaaaatattgcaagtataat |
429 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
41184197 |
taggaagaaatcattttcttatacaaacacaaattatgtttcacctcaaaaaattgcaaatataat |
41184132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 41184950 - 41184893
Alignment:
| Q |
18 |
ggtttattctacatcttatatttattgagtattcaacaacgtatgagtttaaattaag |
75 |
Q |
| |
|
|||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41184950 |
ggtttaatctacaacttctatttattgagtattcaacaacgtatgagtttaaattaag |
41184893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 87 - 140
Target Start/End: Complemental strand, 41184471 - 41184420
Alignment:
| Q |
87 |
ttagattttgatttcatttttgttgatttggtaacgccgttatgtttcggtgca |
140 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
41184471 |
ttagattttgatttt-tttttgttgatttg-taacgccgtaatgtttcggtgca |
41184420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University