View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18706_low_14 (Length: 281)
Name: NF18706_low_14
Description: NF18706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18706_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 9e-36; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 80 - 179
Target Start/End: Complemental strand, 33116002 - 33115902
Alignment:
| Q |
80 |
gcaaaattctgtcacatagtggttgtagcatcgctaaaacactgtttt-gtagcggatttgaacaaactattgattgacaacattggacaaaacaatgta |
178 |
Q |
| |
|
|||||||||||||||||| || |||||||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116002 |
gcaaaattctgtcacataatgattgtagcatccctaagacactgtttttgtagcggatttgaacaaactattgattgacaacattggacaaaacaatgta |
33115903 |
T |
|
| Q |
179 |
g |
179 |
Q |
| |
|
| |
|
|
| T |
33115902 |
g |
33115902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 218 - 263
Target Start/End: Complemental strand, 33115910 - 33115865
Alignment:
| Q |
218 |
acaatatagatgatttaactaacctttcgaaacaaccaacgaggtg |
263 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33115910 |
acaatgtagatgatttaactaacctttcgaaacaaccaacgaggtg |
33115865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 14 - 59
Target Start/End: Complemental strand, 33116048 - 33116003
Alignment:
| Q |
14 |
ttctcagaattgcttttccttcctcctctttaccctgtaaagacaa |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33116048 |
ttctcagaattgcttttccttcctcctctttaccctgtagagacaa |
33116003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University