View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18706_low_17 (Length: 238)
Name: NF18706_low_17
Description: NF18706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18706_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 5 - 219
Target Start/End: Original strand, 33904130 - 33904345
Alignment:
| Q |
5 |
atggacatcatcatatattcatggacggatatggattccttgctgtgggggaacaacgcagtcacacaatcaagacgatgaagtctgtatgattgagata |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33904130 |
atggacctcatcatatattcatggacggatatggattccttgcagtgggggaataacgcagtcacacaatcaagacgatgaagtccgtatgattgagata |
33904229 |
T |
 |
| Q |
105 |
ggaagatgtagattaaacg-tttagtaaataaacaaaaactattataattgatcggacgactatgatcacgttaccgtcaccatttgattacaggtaatc |
203 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33904230 |
ggaagatgtagattaaacgttttagtaaataaacaaaaactattataattgatcggacgactatgatcacgttaccgtcaccatttaattacaggtaatc |
33904329 |
T |
 |
| Q |
204 |
catttcatgatcggac |
219 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33904330 |
catttcatgatcggac |
33904345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 153 - 203
Target Start/End: Original strand, 33904337 - 33904387
Alignment:
| Q |
153 |
tgatcggacgactatgatcacgttaccgtcaccatttgattacaggtaatc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33904337 |
tgatcggacgactatgatcacgttaccgtcaccatttgactacaggtaatc |
33904387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University