View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18707_high_38 (Length: 219)
Name: NF18707_high_38
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18707_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 4298567 - 4298762
Alignment:
| Q |
17 |
aaaggtaacaatttctgctatgtaatatatacacatgtgtttgtg--------aaggaacaaagttacttcacgagtaattctgcttaataactcatcat |
108 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| |||| |||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4298567 |
aaaggtaacaatttctgctatataatatatacacgtgtgtgtgtgtgtgtgtgaagggatgaagttacttcacgagtaattctgcttaataactcatcat |
4298666 |
T |
 |
| Q |
109 |
aaaccttgattctcaccaatccaaagtttcttaaaatccagaatttgtagctatgtgatctgacagtaaacatttgcttatattttttaaagagct |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4298667 |
aaaccttgattctcaccaatccaaagtttcttaaaatccagaatttgcagctatatgatctgacagtaaacatttacttatattttttaaagagct |
4298762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University