View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18707_low_11 (Length: 363)
Name: NF18707_low_11
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18707_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 152
Target Start/End: Original strand, 19221145 - 19221278
Alignment:
| Q |
18 |
caaacattattatggatccaatcttttttagggtcttggatccattctattctaccataactagaaaattagaaattatatgctatgtaagaaagtataa |
117 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19221145 |
caaacattattgtggatccaatatttt-tagggtcttggatccattctattctaccataactagaaaattagaaattatatgctatgtaagaaagtataa |
19221243 |
T |
|
| Q |
118 |
tcacatgtttaaaagggaaggcttcttttatgcca |
152 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
19221244 |
tcacaggtttagaagggaagacttcttttatgcca |
19221278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University