View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18707_low_19 (Length: 306)
Name: NF18707_low_19
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18707_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 130 - 299
Target Start/End: Original strand, 53498144 - 53498313
Alignment:
| Q |
130 |
ctttatttacctgatgatagtgacctcaatcttatttaatacctcgtgctcatccaattgtaacaacgtacatcctctaccctgctccaccagtattacc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53498144 |
ctttatttacctgatgatagtgacctcaatcttatttaatacctcgtgctcatccaattgtaacaacgtacatcctctaccctgctccaccagtattacc |
53498243 |
T |
 |
| Q |
230 |
tttactttgttacttttatttaatccatggtttcattaattaaatacgacaaagtttattgcctatgcta |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53498244 |
tttactttgttacttttatttaatccatggtttcattaattaaatacgacaaagtttattgcctatgcta |
53498313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 24 - 59
Target Start/End: Original strand, 53498043 - 53498078
Alignment:
| Q |
24 |
gacggtgaccgtgaccttatccatccactaactaag |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53498043 |
gacggtgaccgtgaccttatccatccactaactaag |
53498078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University