View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18707_low_21 (Length: 284)
Name: NF18707_low_21
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18707_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 68 - 165
Target Start/End: Original strand, 45084297 - 45084394
Alignment:
| Q |
68 |
tgctcgtttggatttgcgttcaaactctctcaaacgtgcgaaatccgaactctataaattgaagcttgtggcttttacgttagaaatatcttgggaag |
165 |
Q |
| |
|
|||| ||||||||||| |||| |||||||||||||||||||||||| |||| || ||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
45084297 |
tgcttgtttggatttgtgttccaactctctcaaacgtgcgaaatccaaactatacaaatttgagcttgtggcttttacgttggaaatatcttgagaag |
45084394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 45084385 - 45084442
Alignment:
| Q |
184 |
tcttgggaagtgggtgcaaacatgagtctattggcgcagatgtgaaaccaaacacata |
241 |
Q |
| |
|
||||| |||||| ||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
45084385 |
tcttgagaagtgtatgcaaacgtgagcctattggtgcagatgtgaaaccaaacacata |
45084442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 17 - 66
Target Start/End: Original strand, 29477287 - 29477336
Alignment:
| Q |
17 |
agatttggcaaaattacaatatctcatcaaaattttaacaaattcactaa |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29477287 |
agatttggcaaaattacaatatctcatcaaaattttaacaaattcactaa |
29477336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 64 - 145
Target Start/End: Complemental strand, 39753608 - 39753528
Alignment:
| Q |
64 |
taagtgctcgtttggatttgcgttcaaactctctcaaacgtgcgaaatccgaactctataaattgaagcttgtggcttttac |
145 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||| | |||| | |||| |||||||||||||||| |
|
|
| T |
39753608 |
taagtgcttgtttggatttgcgt-caaactctctcaaacgtgcgaaatccagattctacagattggagcttgtggcttttac |
39753528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University