View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18707_low_24 (Length: 275)
Name: NF18707_low_24
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18707_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 77041 - 76794
Alignment:
| Q |
18 |
agttaaaggatataaatagtttgcagtaagtattatgttacacttattttttgaaggataccgtacttgggttgtatctctaaatttttgttgttaatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
77041 |
agttaaaggatataaatagtttgcagtaagtattatgttacacttattttttgaaggataccgtacttgggttgtatctctaaatttttgttgttaatta |
76942 |
T |
 |
| Q |
118 |
caaagaactggaggaaactcttggaaaactgggccagcaccacctcctcctcccggtacacctcctatcaagcaccattccgaggaaaaggaaggaaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
76941 |
caaagaactggaggaaactcttggaaaactgggccagcaccacctcctcctcccggtacacctcctatcaagcatcattccgaggaaaaggaaggaaaat |
76842 |
T |
 |
| Q |
218 |
catcaaattctcttgttactggattgattatagctggcattgcctttg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
76841 |
catcaaattctcttgttactggattgattatagctggcattgcctttg |
76794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University