View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18707_low_33 (Length: 248)
Name: NF18707_low_33
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18707_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 6221145 - 6220936
Alignment:
| Q |
22 |
atttaggggaaaaagattccagtaatgcagcggtaaacgtgaggtaaataaagtctgataaaaagnnnnnnnatccaagaaacgaacttgagttcttccg |
121 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||| |||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
6221145 |
atttaggggaaaaagattccagtaaagcagcgctaagcgtgag-taaataaagtctgataaaaagttattttatccaagaaacgaactcgagttcttccg |
6221047 |
T |
 |
| Q |
122 |
aacaatttatttttaagtaaaactcattaaccacttgaacataattggtgtgcattaatctttgtgtgaatgttatgttaccttctcacaaccagaatca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6221046 |
aacaatttatttttaagtaaaactcattaatcacttgaacgtaattggtgtgcattaatctttgtgtgaatgttatgttaccttctcacaaccagaatca |
6220947 |
T |
 |
| Q |
222 |
tattaaagatg |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
6220946 |
tattaaagatg |
6220936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University