View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18707_low_34 (Length: 248)
Name: NF18707_low_34
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18707_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 24283304 - 24283097
Alignment:
| Q |
19 |
taggttcacaacaaaaatcctactttcaacagtctaaaaccctagcactagctaaaactaaactatggatcttacattactaccctttaaaaagaagttg |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24283304 |
taggttcacgacaaaaatcctactttcaacagtctaaaaccctagcactagctaaaactaaactatggatcttacattactaccctttaaaaagaagtcg |
24283205 |
T |
|
| Q |
119 |
cgtcctcaaggtgtcgatgaacaacccatggtataattttatcatcttgctttccatcccccaagtcgcattcctcgggtttggttctaattaactttca |
218 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24283204 |
cgtcctcaaggtgtcaatgaataacccatggtataattttatcatcttgctttccatcccccaagtcgcattcctcgggtttgtttctaattaactttca |
24283105 |
T |
|
| Q |
219 |
acaatggt |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
24283104 |
acaatggt |
24283097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University