View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18707_low_42 (Length: 227)

Name: NF18707_low_42
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18707_low_42
NF18707_low_42
[»] chr5 (1 HSPs)
chr5 (1-215)||(36080178-36080394)


Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 36080394 - 36080178
Alignment:
1 catatataaataaaacacaaacatatgaatattttgagagttaatttttagaaaattaaggtgtctccagaatttagactatctcttccaacaaatgcat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
36080394 catatataaataaaacacaaacatatgaatattttgagagttaatttttagaaaattaaggtgtctccagaatttagaccatctcttccaacaaatgcat 36080295  T
101 gttttccactacactaaaataacatactagcaattctatagaactagcaatcatatgttagc--tttcttgtttctctagaaaatcttgtcgaatggaat 198  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||    
36080294 gttttcgactacactaaaataacatactagcaattctatagaactagcaatcatatattagctttttcttgtttctctagaaaatcttgtcgaatggaat 36080195  T
199 ccttgaacacgccatgg 215  Q
    |||||||||||||||||    
36080194 ccttgaacacgccatgg 36080178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University