View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18707_low_48 (Length: 207)

Name: NF18707_low_48
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18707_low_48
NF18707_low_48
[»] chr8 (1 HSPs)
chr8 (5-191)||(15229720-15229906)


Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 5 - 191
Target Start/End: Complemental strand, 15229906 - 15229720
Alignment:
5 taatggctctgctagggtttctagcttcgttcgccgtcgatagtgtttccctctcattctaacctttccatttccttgtcaaggtatactggtttatggt 104  Q
    ||||||||||||||||||||||||||| ||||||| ||||||||||||| ||| ||||  ||||||||||||||||||||||||||||||||||||||||    
15229906 taatggctctgctagggtttctagcttggttcgccatcgatagtgtttcactcccattacaacctttccatttccttgtcaaggtatactggtttatggt 15229807  T
105 gcaggtgagatgacaagggctcattcatcatagatgtggtggattgtggtaatggacgaagtttttgccgtagtgtggggactaatt 191  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15229806 gcaggtgagatgacaagggctcgttcatcatagatgtggtggattgtggtaatggacgaagtttttgccgtagtgtggggactaatt 15229720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University