View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18707_low_48 (Length: 207)
Name: NF18707_low_48
Description: NF18707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18707_low_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 5 - 191
Target Start/End: Complemental strand, 15229906 - 15229720
Alignment:
| Q |
5 |
taatggctctgctagggtttctagcttcgttcgccgtcgatagtgtttccctctcattctaacctttccatttccttgtcaaggtatactggtttatggt |
104 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15229906 |
taatggctctgctagggtttctagcttggttcgccatcgatagtgtttcactcccattacaacctttccatttccttgtcaaggtatactggtttatggt |
15229807 |
T |
|
| Q |
105 |
gcaggtgagatgacaagggctcattcatcatagatgtggtggattgtggtaatggacgaagtttttgccgtagtgtggggactaatt |
191 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15229806 |
gcaggtgagatgacaagggctcgttcatcatagatgtggtggattgtggtaatggacgaagtttttgccgtagtgtggggactaatt |
15229720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University