View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18709_high_11 (Length: 365)
Name: NF18709_high_11
Description: NF18709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18709_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 122 - 276
Target Start/End: Complemental strand, 50506819 - 50506665
Alignment:
| Q |
122 |
tttttacttatatgtctattcgtttcccattgcaatttttgctaagtttctgtttcaattttattgcaaaacaaatcaaacataacattaaacaataata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50506819 |
tttttacttatatgtctattcgtttcccattgcaatttttgctaagtttctgtttcaattttattgcaaaacaaatcaaacataacattaaacaataata |
50506720 |
T |
|
| Q |
222 |
tgaaatatgtctctgtatttgaatcttattgttaacttttttgttgagttccttt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
50506719 |
tgaaatatgtctctgtatttgaatcttattgttaatttttttgtcgagttccttt |
50506665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 16 - 120
Target Start/End: Complemental strand, 50506961 - 50506857
Alignment:
| Q |
16 |
atgaatattgaccaatcttaatactcacagatattacaaacggtaaaaagtgacatatttgcaaatgactataaacaaacaaatattttttgaacgacta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50506961 |
atgaatattgaccaatcttaatactcacagatattacaaacggtaaaaagtgacatatttgcaaatgactataaacaaacaaatattttttgaacgacta |
50506862 |
T |
|
| Q |
116 |
agaaa |
120 |
Q |
| |
|
||||| |
|
|
| T |
50506861 |
agaaa |
50506857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University