View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18709_high_14 (Length: 319)
Name: NF18709_high_14
Description: NF18709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18709_high_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 32992773 - 32992483
Alignment:
| Q |
1 |
caagttgatttagattaattagttttattatatgccaatgcccccaatagtgaccttgcttcattgatgagtggtccccactacacaaatgtacaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32992773 |
caagttgatttagattaattagttttat---atgccaatgcccccaatagtgacctggcttcattggtgagtggtccccactacacaaatgtacaatttt |
32992677 |
T |
|
| Q |
101 |
agacccaaaacaaaaattgagaattgagctttcaagtccaaatctgtcctgctataggtcatggagctttcaaggtgtccaagtaaaacaatgttttaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32992676 |
agacccaaaacaaaaattgagaattgagctttcaagtccaaatctgtcctgctataggtcatggagctttcaaggtgtccaagtaaaacaatgttttaaa |
32992577 |
T |
|
| Q |
201 |
actagaattgattcgattagatttttgagtcatggttcagttgattcaatcattttaactaagtttgaactagataacaaatattttcttcatcttatat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32992576 |
actagaattgattcgattagatttttgagtcatagttcagttggttcaatcattttaactaagtttgaa------aacaaatattttcttcatcttatat |
32992483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University