View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18709_high_29 (Length: 222)
Name: NF18709_high_29
Description: NF18709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18709_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 44 - 186
Target Start/End: Original strand, 31079461 - 31079607
Alignment:
| Q |
44 |
cttaaaaattaggcgaggaactcgtgagatgagtagaagatttaaattgttggatgtgtgtgcaacgtgattttgaagcaatcagattctttatcgttac |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31079461 |
cttaaaaattaggcgaggaactcgtgagatgagtagaagatttaaattgttggatgtgtgggcaacgtgattttgaagcaatcagattctttatcgttac |
31079560 |
T |
 |
| Q |
144 |
aat----gttgtcgcgaatcagattacaaagttgttcgcattcgcac |
186 |
Q |
| |
|
||| |||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
31079561 |
aatatacgttgtcgcaaatcaggttacaaagttgttcgcattcgcac |
31079607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University