View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18709_high_6 (Length: 424)

Name: NF18709_high_6
Description: NF18709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18709_high_6
NF18709_high_6
[»] chr8 (2 HSPs)
chr8 (186-276)||(15737250-15737340)
chr8 (1-114)||(15737067-15737177)


Alignment Details
Target: chr8 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 186 - 276
Target Start/End: Original strand, 15737250 - 15737340
Alignment:
186 cttttgatcaaaacaaattatagagttaatgtgccaatcatagtaatctaggatgtcttgaagcaattttgtttaatccgataaaatgttt 276  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
15737250 cttttgatcaaagcaaattatagagttaatgtgccaatcatagtaatctaggatgtctcgaagcaattttgtttaatccgataaaatgttt 15737340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 15737067 - 15737177
Alignment:
1 aaactatttttgaatggtacaaaaagcaatttttacccacattatgtggttgcctatgaagccccgatttacaaannnnnnnataataaaacatatatgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||  ||||||    
15737067 aaactatttttgaatggtacaaaaagcaatttttacccacattatgtggttgcctatgaagccccgatttacaaa-ttttttataataaaac--atatgc 15737163  T
101 atgtaaacttcttg 114  Q
    ||||||||||||||    
15737164 atgtaaacttcttg 15737177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University