View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18709_low_14 (Length: 330)
Name: NF18709_low_14
Description: NF18709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18709_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 24 - 328
Target Start/End: Complemental strand, 28928088 - 28927784
Alignment:
| Q |
24 |
aatggtcgcgttgagccctttttggcatgtcacaggttgaatagtttgacccttgattattataaaatcatggatgcaaaaacgctttgcatatcaaatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28928088 |
aatggtcgcgttgagccctttttggcatgtcacaggttgaatagtttgacccttgattattatagaatcatggatgcaaaaacgctttgcatatcaaatt |
28927989 |
T |
 |
| Q |
124 |
tcatgcttgtcaatttaaatatgcgtagtagttatcttggggagtgtttcgaaatggagctatccacaccaaacctttgtacctttgaatttggagttac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28927988 |
tcatgcttgtcaatttaaatatgcgtagtagttatcttggggagtgtttcgaaatggagctatccacaccaaatctttgtacctttgaatttggagttac |
28927889 |
T |
 |
| Q |
224 |
acctcttccgaaactctgtgggagtaagagcaatctctcttctatcaagcatggatatattgatgtttcaatgctggtgaatgatgcggatactcctttg |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28927888 |
acctcttccgaaactctgtgggagtaagagcaatctctcttctatcaagcatgcatatattgatgtttcaatgctggtcaatgatgcggatactcctttg |
28927789 |
T |
 |
| Q |
324 |
cttct |
328 |
Q |
| |
|
|||| |
|
|
| T |
28927788 |
attct |
28927784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 180 - 276
Target Start/End: Complemental strand, 14288374 - 14288278
Alignment:
| Q |
180 |
gagctatccacaccaaacctttgtacctttgaatttggagttacacctcttccgaaactctgtgggagtaagagcaatctctcttctatcaagcatg |
276 |
Q |
| |
|
||||||||||| |||| || |||| |||| | ||| | | ||| ||||||| |||||| |||||||||| | |||||||||||||||||| |||| |
|
|
| T |
14288374 |
gagctatccactccaagtctctgtaacttttattttaggggtactcctcttcaaaaactccgtgggagtaaaatcaatctctcttctatcaaacatg |
14288278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University