View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18709_low_29 (Length: 236)
Name: NF18709_low_29
Description: NF18709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18709_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 10 - 204
Target Start/End: Complemental strand, 33740180 - 33739976
Alignment:
| Q |
10 |
acatcatcaaagtactatcaaccattagtctttgtaatgtgatcctattcatgaagattgtaaccaaaacctttgctaaccgcctcaagtttattctct- |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33740180 |
acatcatcaaagtactatcaaccattagtctttgtaatgtgatcctattcatgaagattgtaaccaaaacctttgctaaccgcctcaagtttattctctc |
33740081 |
T |
 |
| Q |
109 |
--tcattgatgaggaacaaagcgct-------taatgcctaacattcaaataaattaatgtaacttaaattaaattaaaatgctagggcgccgcagataa |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33740080 |
tatcattgatgaggaacaaagcgcttataaaataatgcctaacattcaaataaattaatgtaacttaaattaaattaaaatgctagggcgccgcagataa |
33739981 |
T |
 |
| Q |
200 |
tttat |
204 |
Q |
| |
|
||||| |
|
|
| T |
33739980 |
tttat |
33739976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University