View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18709_low_5 (Length: 486)
Name: NF18709_low_5
Description: NF18709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18709_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 14 - 256
Target Start/End: Original strand, 48883632 - 48883878
Alignment:
| Q |
14 |
tgagtagaattaaaattaaacaatgctctaaagtggagaatgag----tgatcaccatcagtaagtgtcaagacctgagtggatgacactaaaaaggttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883632 |
tgagtagaattaaaattaaacaatgctccaaagtggagaatgagtgagtgatcactatcagtaagtgtcaagacctgagtggatgacactaaaaaggttg |
48883731 |
T |
|
| Q |
110 |
ggggaactaattctttgcttcataattatcaataagctaagacctttttagagcgtgtggtccactagttggtgaatgaattatatagaacaatattgtg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883732 |
ggggaactaattctttgcttcataattatcaataagctaagatctttttagagcttgtggtccactagttggtgaatgaattatatagaacaatattgtg |
48883831 |
T |
|
| Q |
210 |
atcaataccataggtattttataaaaatattagtatgatcattattt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883832 |
atcaataccataggtattttataaaaatattagtatgatcattattt |
48883878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 309 - 470
Target Start/End: Original strand, 48883874 - 48884035
Alignment:
| Q |
309 |
tatttggaacatcacttcttttgaagaaagtacggaacctgggacatgagtttgaggaaattacagtttggaacaaccattatagttgtccaaaaatgtg |
408 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48883874 |
tatttgcaacatcacttcttttgaagaaagtacggaacttgggacatgagtttgaggaaattacagtttggaacaaccgttatagttgtccaaaaatgtg |
48883973 |
T |
|
| Q |
409 |
tagcctagaggtttgatacctatggctaacattttcaccatgtcctctaaaaatttagtgac |
470 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883974 |
tagcctagaggtttggtacctatggctaacattttcaccatgtcctctaaaaatttagtgac |
48884035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University