View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18709_low_7 (Length: 424)
Name: NF18709_low_7
Description: NF18709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18709_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 186 - 276
Target Start/End: Original strand, 15737250 - 15737340
Alignment:
| Q |
186 |
cttttgatcaaaacaaattatagagttaatgtgccaatcatagtaatctaggatgtcttgaagcaattttgtttaatccgataaaatgttt |
276 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15737250 |
cttttgatcaaagcaaattatagagttaatgtgccaatcatagtaatctaggatgtctcgaagcaattttgtttaatccgataaaatgttt |
15737340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 15737067 - 15737177
Alignment:
| Q |
1 |
aaactatttttgaatggtacaaaaagcaatttttacccacattatgtggttgcctatgaagccccgatttacaaannnnnnnataataaaacatatatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
15737067 |
aaactatttttgaatggtacaaaaagcaatttttacccacattatgtggttgcctatgaagccccgatttacaaa-ttttttataataaaac--atatgc |
15737163 |
T |
 |
| Q |
101 |
atgtaaacttcttg |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15737164 |
atgtaaacttcttg |
15737177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University