View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18709_low_8 (Length: 422)
Name: NF18709_low_8
Description: NF18709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18709_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 6e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 255 - 404
Target Start/End: Complemental strand, 51498092 - 51497941
Alignment:
| Q |
255 |
ttaccttcatcgcgtgaacagttccatatctgtgacagaaaataagggtgcatcaggttccaaattaaaacatgcac-aattcacaacaacggta-tgga |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| ||||||| |||||||||||||||| |||||||||| |||||||||||| | | |||| |
|
|
| T |
51498092 |
ttaccttcatcacgtgaacagttccatatctgtaacagaaattaagggtacatcaggttccaaattcaaacatgcacaaattcacaacaaaagcactgga |
51497993 |
T |
 |
| Q |
353 |
ctacaactagtgcacaaaccagatacacctaaagccaacaaggaactgaatt |
404 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
51497992 |
ctacaactagtgcaaaagccagatacacctaaagccaacaaggaactgaatt |
51497941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 155 - 200
Target Start/End: Complemental strand, 48963298 - 48963253
Alignment:
| Q |
155 |
tttaatattatttaattcctgattaaaatattgcaatttaatcgta |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48963298 |
tttaatattatttaattcttgattaaaatattgcaatttaatcgta |
48963253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 255 - 287
Target Start/End: Original strand, 19526270 - 19526302
Alignment:
| Q |
255 |
ttaccttcatcgcgtgaacagttccatatctgt |
287 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
19526270 |
ttaccttcatctcgtgaacagttccatatctgt |
19526302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University