View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1870_high_15 (Length: 250)
Name: NF1870_high_15
Description: NF1870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1870_high_15 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 14 - 250
Target Start/End: Complemental strand, 52710943 - 52710707
Alignment:
| Q |
14 |
atatgctaatatcatagcgacatatagtggcacaatcgccgctaaaacattgtaaatgtccttgccggtaatcatggttatagatatgtcaaggtaggtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52710943 |
atatgctaatatcatagcgacatatagtggcacaatcgccgctaaaacattgtatatgtccttgccggtaatcatggttatagatatgtcaaggtaggtt |
52710844 |
T |
 |
| Q |
114 |
agagacacggaaattatatgagagttcgtaaatatctgcgtatgaatattgaatataattgattgattataaggctaacgccgcgcattgtaaacgttca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52710843 |
agagacacggaaattatatgagagttcgtaaatatctgcgtataaatattgaatataattgattgattataaggctaacgccgcgcattgtaaacgttca |
52710744 |
T |
 |
| Q |
214 |
tgggcatggaagttgggcagtattttgtgatgtgcaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52710743 |
tgggcatggaagttgggcagtattttgtgatgtgcaa |
52710707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 52716250 - 52716149
Alignment:
| Q |
15 |
tatgctaatatcatagcgacatatagtggcacaatcgccgctaaaacattgtaaatgtccttgccggtaatcatggttatagatatgtcaaggtaggtta |
114 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||| || || ||||||| ||| || ||||| |||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
52716250 |
tatgctaatatcatagcaacatatagcggcacaattgctgcgaaaacatcgtatatatccttaccggtaatcatggttatagataggtcaaggtagatta |
52716151 |
T |
 |
| Q |
115 |
ga |
116 |
Q |
| |
|
|| |
|
|
| T |
52716150 |
ga |
52716149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University