View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1870_high_25 (Length: 237)
Name: NF1870_high_25
Description: NF1870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1870_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 11 - 221
Target Start/End: Complemental strand, 52710577 - 52710383
Alignment:
| Q |
11 |
cttgttgagtgagaaataattagaacaccagcgagtaaacttcatcagattattgttacaacaatgtatttgttagagttggaattgtgctgtgaattag |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52710577 |
cttgttgtgtgagaaataattagaacaccagcgagtaaacttcatcagattatt----------------tgttagagttggaattgtgctgtgaattag |
52710494 |
T |
 |
| Q |
111 |
tggacattggccttttattgatataaagatgacaaatgtgattcaaactaaattctcgtagccttccatcggtcaattcaaggctataacagaatgtaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52710493 |
tggacattggccttttattgatataaagatgacaaatgtgattcaaactaaattctcgtagccttccatcggtcaattcaaggctataacagaatgtaac |
52710394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University