View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1870_high_32 (Length: 202)
Name: NF1870_high_32
Description: NF1870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1870_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 30024400 - 30024585
Alignment:
| Q |
1 |
acgattactttatttctatcaaaagtct--ttgggaagaattggagatttttcacccgattccacattgcacacactcgtttttgttatctaaaatcgta |
98 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30024400 |
acgattactttacttctatcaaaagtctctttgggaagaattggagatttttcacccgattccacattgcacacactcgtttttgttatctaaagtcgta |
30024499 |
T |
 |
| Q |
99 |
agagtttaggaaattaatttgagagtttgacaattttaatttaattttacacatgaatgatagtgttgtgaattcggactcgaaatc |
185 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| | ||||||| | ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
30024500 |
agagtttagg-aattaatttgagagtttgacaattttaattgacttttacataggaatgatagtgttgtaaattcggactcaaaatc |
30024585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 113 - 161
Target Start/End: Original strand, 35841909 - 35841957
Alignment:
| Q |
113 |
taatttgagagtttgacaattttaatttaattttacacatgaatgatag |
161 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
35841909 |
taatttgagagtttgacaattttaattcaattttacataggaatgatag |
35841957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University