View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1870_low_12 (Length: 307)
Name: NF1870_low_12
Description: NF1870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1870_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 21 - 294
Target Start/End: Complemental strand, 8180924 - 8180651
Alignment:
| Q |
21 |
aaacttcgattttgttgaatcgaatttttgaactgcggtcgtggtaactgtcacagttgcgcctcgatccttgatattatagacaatcacagttaaaatg |
120 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
8180924 |
aaactttgattttgttgaatcgaatttttgaactgcggtcgtggtaactgtcacagttgcgcctcgatcctagatattatagacaatcacaattaaaatg |
8180825 |
T |
 |
| Q |
121 |
tagttgatgcggcctcagttgcagtcatgttctggtcatggaggcatcaaaacctcgcagcacatgacatcaatgcattaacaaaactcactgcacataa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8180824 |
tagttgatgcggcctcagttgcagtcatgttctggtcacggaggcatcaaaacctcgcagcacatgacatcaatgcattaacaaaactcactgcacataa |
8180725 |
T |
 |
| Q |
221 |
cattaatgcatgaacattaatacacaaattcataggaatactaaactctagacttaaatcaatatgatcatgat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
8180724 |
cattaatgcatgaacattaatacacaaattcataggaatactaaactctagagttaaatctatatgatcatgat |
8180651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University