View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1870_low_14 (Length: 280)
Name: NF1870_low_14
Description: NF1870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1870_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 147 - 266
Target Start/End: Complemental strand, 3594257 - 3594138
Alignment:
| Q |
147 |
tggaaacatacgtttgtatcatttgtggatctacttattcctcttcctcatttaaataattttataattccctttcacatgaatgaacatgttcatactg |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3594257 |
tggaaacatacgtttgtataatttgtggatctacttattcctcttcctcatttaaataattttataattccctttcacatgaatgaacatgttcatactg |
3594158 |
T |
|
| Q |
247 |
taagcattcaattcgattcc |
266 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3594157 |
taagcattcaattcgattcc |
3594138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 3594352 - 3594313
Alignment:
| Q |
18 |
tgaacctcacctctgcatataatatgcagtatatccctac |
57 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
3594352 |
tgaacctcgcctctgcatataatatgcaatatatccctac |
3594313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University