View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1870_low_18 (Length: 250)
Name: NF1870_low_18
Description: NF1870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1870_low_18 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 144 - 250
Target Start/End: Original strand, 3617115 - 3617220
Alignment:
| Q |
144 |
gtacactataattgttcttttgtttaaggaatatgtgttgttaatctattaattataattgattttagtagtagctcacccgaattttttcagtccagct |
243 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
3617115 |
gtacactataattgttgtttt-tttaaggaatatgtgttgttaatctattaattataattgattttagtagtagctcacccgaatatttttagtccagct |
3617213 |
T |
 |
| Q |
244 |
ccaccat |
250 |
Q |
| |
|
||||||| |
|
|
| T |
3617214 |
ccaccat |
3617220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 16 - 75
Target Start/End: Original strand, 3616987 - 3617046
Alignment:
| Q |
16 |
cagatattaataataatttttaagatcaactttcatgacacgtcattgtgagtgtagaac |
75 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3616987 |
cagacattaataataatttttaagatcaactttcatgacacgtcattgtgagtgtagaac |
3617046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University