View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1870_low_24 (Length: 238)
Name: NF1870_low_24
Description: NF1870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1870_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 13770896 - 13770677
Alignment:
| Q |
1 |
taacttgcatctcccctttaccctctacaaagcataaagtggtaagaaaaatgagaaatatgcaaaatggaac--------------atagaactgaaga |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
13770896 |
taacttgcatctcccctttaccctctacaaagcataaagtggtaagaaaaatgagaaaaatgcaaaatggaaccctgaacaaagaacatagaactgaaga |
13770797 |
T |
|
| Q |
87 |
agatatttctagtacccgatctttattactgttgaggttcctgcaaagtcccaggccatgagacaattgcagggaaccaggaagagccattatagtatca |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770796 |
agatatttctagtacccgatctttattactgttgaggttcctgcaaagtcccaggccatgagacaattgcagggaaccaggaagagccattatagtatca |
13770697 |
T |
|
| Q |
187 |
aattatatagccttgcagac |
206 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13770696 |
aattatatagccttgcagac |
13770677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University