View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18712_high_14 (Length: 282)
Name: NF18712_high_14
Description: NF18712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18712_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 53 - 266
Target Start/End: Original strand, 32046132 - 32046347
Alignment:
| Q |
53 |
tatataactgctctaagaatctctttctcccgagattctacgagggaaatcattcga--ttttagtgctgcacacgagttgcatcgaatcacgttttaac |
150 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32046132 |
tatataactactctaagaatctctttctcccgagattctacgagggaaatcattcgagattttagtgctgcacacgagttgcatcgaatcacgttttaac |
32046231 |
T |
 |
| Q |
151 |
tgtacctgcatgtatgccatgtgccttccnnnnnnntgttcatgctcatgcatatttgacaaaaggtaaataaagtattttaggatacatgatattcagc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32046232 |
tgtacctgcatgtatgccatgtgccttccagaaaaatgttcatgctcatgcatatttgacaaaaagtaaataaagtattttaggatacatgatattcagc |
32046331 |
T |
 |
| Q |
251 |
gattcaacaaagtatg |
266 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32046332 |
gattcaacaaagtatg |
32046347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 32045781 - 32045834
Alignment:
| Q |
1 |
agtaataatcaataatttatgatgaggctttagtaaactatcgtccaaaacata |
54 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
32045781 |
agtaataatcaataatttatgacgaggttttagtaaactatcgtccaaaacata |
32045834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University