View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18712_high_17 (Length: 244)
Name: NF18712_high_17
Description: NF18712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18712_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 14136320 - 14136531
Alignment:
| Q |
1 |
acccaccttagatgataagtactacctgtgtattttttattttggtgcaaacgcttattgttttatatttcttgattttataaaaatataaacaaaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14136320 |
acccaccttagatgataagtactacctgtgcattttttattttggtgcaaacgcttattgttttatatttcttgattttataaaaatataaacaaaacaa |
14136419 |
T |
 |
| Q |
101 |
ctcgtatttttccactatgtctccctacctaaaacctcaacaggaaaacaggtggtttctgcatgtgatgaggcatgcatcagtagcataacgtgaacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14136420 |
ctcgtatttttccactatgtctccctacctaaaacctcaacaggaaaacaggtggtttctgcatgtgatgaggcatgcatcagtagcataacgtgaacat |
14136519 |
T |
 |
| Q |
201 |
ttaatgcatgtg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14136520 |
ttaatgcatgtg |
14136531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University