View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18712_high_20 (Length: 209)

Name: NF18712_high_20
Description: NF18712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18712_high_20
NF18712_high_20
[»] chr1 (1 HSPs)
chr1 (31-199)||(24421365-24421533)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 31 - 199
Target Start/End: Original strand, 24421365 - 24421533
Alignment:
31 tgatgatgttgctgtggtggcggcttttcatcttccttttcgattttcattaccggtggaggattgttttgaacagattcttttggttttgttggacttg 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24421365 tgatgatgttgctgtggtggcggcttttcatcttccttttcgattttcattaccggtggaggattgttttgaacagattcttttggttttgttggacttg 24421464  T
131 ttttgtgtgcactatctttcttggaacgtgaccagcaagatggacttggaaaagttgcgcgtgatgatg 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
24421465 ttttgtgtgcactatctttcttggaacgtgaccagcaagatggacttggaaaagttgcacgtgatgatg 24421533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University