View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18712_high_7 (Length: 407)
Name: NF18712_high_7
Description: NF18712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18712_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 3e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 203 - 400
Target Start/End: Complemental strand, 14225635 - 14225437
Alignment:
| Q |
203 |
tacttgattacaagtttgaattttggtatgcaatgctcttgaaaatccaaatcttatgatacgtatcaggttatgataaaaaa-taaaccagcacagtca |
301 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||||||||| |||| |
|
|
| T |
14225635 |
tacttgattacaaatttgaattttggtatgcaatgctcttgaaattccaaatcttatgatacttatcaggttatcataaaaaaataaaccagcacggtca |
14225536 |
T |
 |
| Q |
302 |
aacagctcgaatagtgagaggtttaagagtgatgtggtggtcgtgctagagataactcggcaaacagctgacccttcatctaatccttcacctttgctt |
400 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14225535 |
aacagctcgaatggtgagaggtttaagagtgatgtggtggtcgtgctagagataactcggcaaacagctgacccttcatctaatccttcacctttgctt |
14225437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University