View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18712_low_22 (Length: 209)
Name: NF18712_low_22
Description: NF18712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18712_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 31 - 199
Target Start/End: Original strand, 24421365 - 24421533
Alignment:
| Q |
31 |
tgatgatgttgctgtggtggcggcttttcatcttccttttcgattttcattaccggtggaggattgttttgaacagattcttttggttttgttggacttg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24421365 |
tgatgatgttgctgtggtggcggcttttcatcttccttttcgattttcattaccggtggaggattgttttgaacagattcttttggttttgttggacttg |
24421464 |
T |
|
| Q |
131 |
ttttgtgtgcactatctttcttggaacgtgaccagcaagatggacttggaaaagttgcgcgtgatgatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24421465 |
ttttgtgtgcactatctttcttggaacgtgaccagcaagatggacttggaaaagttgcacgtgatgatg |
24421533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University