View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18712_low_23 (Length: 208)

Name: NF18712_low_23
Description: NF18712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18712_low_23
NF18712_low_23
[»] chr8 (1 HSPs)
chr8 (94-139)||(14225739-14225784)


Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 94 - 139
Target Start/End: Original strand, 14225739 - 14225784
Alignment:
94 ttgacaatgttctaaactttcaagaatgaaatccaaatgttcattg 139  Q
    |||||||||||||||||||||||||||||||||||| |||||||||    
14225739 ttgacaatgttctaaactttcaagaatgaaatccaactgttcattg 14225784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University