View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18712_low_24 (Length: 204)
Name: NF18712_low_24
Description: NF18712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18712_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 111 - 194
Target Start/End: Complemental strand, 42743320 - 42743237
Alignment:
| Q |
111 |
gagtattggtacctaacttattgtaatgggtaaataagattctcctttaaaaaattgcgttttaatatgtggttgtagatacat |
194 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42743320 |
gagtattggtacctaacttattgttatgggtaaataagattctcctttaaaaaattgcgttttaatatgtggttgtagatacat |
42743237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 42743426 - 42743377
Alignment:
| Q |
1 |
cttagagtttagttaaatatattagtcgacaatcaatcatttaaagctag |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42743426 |
cttagagtttagttaaatatattagtcgacaaccaatcatttaaagctag |
42743377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University