View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18712_low_9 (Length: 407)

Name: NF18712_low_9
Description: NF18712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18712_low_9
NF18712_low_9
[»] chr8 (1 HSPs)
chr8 (203-400)||(14225437-14225635)


Alignment Details
Target: chr8 (Bit Score: 167; Significance: 3e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 203 - 400
Target Start/End: Complemental strand, 14225635 - 14225437
Alignment:
203 tacttgattacaagtttgaattttggtatgcaatgctcttgaaaatccaaatcttatgatacgtatcaggttatgataaaaaa-taaaccagcacagtca 301  Q
    ||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||||||||| ||||    
14225635 tacttgattacaaatttgaattttggtatgcaatgctcttgaaattccaaatcttatgatacttatcaggttatcataaaaaaataaaccagcacggtca 14225536  T
302 aacagctcgaatagtgagaggtttaagagtgatgtggtggtcgtgctagagataactcggcaaacagctgacccttcatctaatccttcacctttgctt 400  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14225535 aacagctcgaatggtgagaggtttaagagtgatgtggtggtcgtgctagagataactcggcaaacagctgacccttcatctaatccttcacctttgctt 14225437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University