View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18713_low_5 (Length: 312)
Name: NF18713_low_5
Description: NF18713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18713_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 121 - 274
Target Start/End: Complemental strand, 41267419 - 41267266
Alignment:
| Q |
121 |
taagatcaaaagaacctccatttgtaatgttttaagattacgacgagacaaagcaacttcaattacgccgtattattctatcataaattatatttcgatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41267419 |
taagatcaaaagaacctccatttgtaatgttttaacattacgacgagacaaagcaacttcaattacgccgtagtattctatcataaattatatttcgatt |
41267320 |
T |
|
| Q |
221 |
caaatcattaattctaaatatgcgtgtgaaagaaggggttgaaagttgacaaag |
274 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||| ||| |||||||||||| |
|
|
| T |
41267319 |
taaatcattaattctaaatatgcgtataaaagaagggattggaagttgacaaag |
41267266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 19 - 122
Target Start/End: Complemental strand, 41267577 - 41267474
Alignment:
| Q |
19 |
ttcagtgtgtcaattgctccaggttcatattaaatgtcaatgtcttttaaagtaatacgtgcattttaagaaaacgatcttttgctgattacatgtgtat |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41267577 |
ttcagtgtgtcatttgctccaggttcatattaaatgtcaatgtcttttaaagtaatacgtgcattttaagaaaacgatcttttactgattacatgtgtat |
41267478 |
T |
|
| Q |
119 |
ttta |
122 |
Q |
| |
|
|||| |
|
|
| T |
41267477 |
ttta |
41267474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University