View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18714_high_13 (Length: 328)
Name: NF18714_high_13
Description: NF18714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18714_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 173 - 325
Target Start/End: Complemental strand, 13746627 - 13746474
Alignment:
| Q |
173 |
atctaaaatttaaaagttgtttcctatctt-ataaaatggacaaatttttattgaaccccgtcaatatttttctttgatttttatcactctacaacatga |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13746627 |
atctaaaatttaaaagttgtttcctatctttataaaatggacaaatttttattgaaccccgtcaatatttttctttgatttttatcactctacaacatga |
13746528 |
T |
|
| Q |
272 |
catctccttttgtgatgttcaatttaggggttgatgaatttatattcttggaca |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
13746527 |
catctccttttgtgatgttcaatttaggggttgatgaatttatttttttggaca |
13746474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 59 - 190
Target Start/End: Complemental strand, 13746775 - 13746642
Alignment:
| Q |
59 |
tatccaaattctactattctagtatatata--ataaagctaaatatgtttgtggtccctatgaaatgaatgaattttggctttgatcccaataaaaattt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
13746775 |
tatccaaattctactattctagtatatatataataaatctaaatatgtttgtggtccctatgaaatgaatgaattttggctttgattccaataaaaaatt |
13746676 |
T |
|
| Q |
157 |
tctttgatttccattcatctaaaatttaaaagtt |
190 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
13746675 |
tctttgatttacattcatctaaaatttaaaagtt |
13746642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University