View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18714_high_23 (Length: 243)
Name: NF18714_high_23
Description: NF18714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18714_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 32195431 - 32195221
Alignment:
| Q |
18 |
agggggtcaagaaaatactcatcatatatgttgaaattacttggaacaccgatttgatacgcacttccctaccggctctagatagtgcctttccactcca |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32195431 |
agggggtcaaggaaatactcatcatatatgctgaaattacttggaacaccgatttgatacgcacttccctaacggctctagatagtgcctttccactcca |
32195332 |
T |
 |
| Q |
118 |
agagttcannnnnnnnccacacacaatctttgataattttgaacattgactttttgcttcttcctatcgtagatgacaaccccaaacatttgcatgtacc |
217 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32195331 |
agagttcattttttttccacacacaatctctgataattttgaacattgactttttgcttcttcctatcgtagatgacaaccccaaacatttgcatgtacc |
32195232 |
T |
 |
| Q |
218 |
atgagctatat |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
32195231 |
atgagctatat |
32195221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University