View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18714_high_28 (Length: 224)
Name: NF18714_high_28
Description: NF18714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18714_high_28 |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 7e-42; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 51 - 208
Target Start/End: Complemental strand, 16399035 - 16398885
Alignment:
| Q |
51 |
atatataattctaaacattacttacctcttttattaaaaactataggtgcgaaatataatccggtcttttannnnnnngagtgaatcatccggactttta |
150 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||| |
|
|
| T |
16399035 |
atatatagttctaaacattacctaccttttttattaaaaactataggtgcgaaatataatccggtcttttatttttttgggtgaatcatccagactttta |
16398936 |
T |
 |
| Q |
151 |
taaaaacacatgttataacttatacgtatatacaataattgtttagtataaaaaagct |
208 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16398935 |
taaaaacacatg-------ttatacgtacatacaataattgtttagtataaaaaagct |
16398885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 20 - 121
Target Start/End: Complemental strand, 27475627 - 27475527
Alignment:
| Q |
20 |
tagacttttcacccgtgctgccgcacggatcatatataattctaaacattacttacctcttttattaaaaactataggtgcgaaatataatccggtcttt |
119 |
Q |
| |
|
||||||||| |||| ||||| |||||| |||||||||||||||||||||||| | | |||||||||||| |||||||| ||||||| || ||||||| |
|
|
| T |
27475627 |
tagactttttacccatgctgtcgcacgaatcatatataattctaaacattacctgcactttttattaaaaa-tataggtgtgaaatatcatgtggtcttt |
27475529 |
T |
 |
| Q |
120 |
ta |
121 |
Q |
| |
|
|| |
|
|
| T |
27475528 |
ta |
27475527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 15961364 - 15961324
Alignment:
| Q |
15 |
aatactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
15961364 |
aatactagactttccacccgtgctgccgcacgggtcatata |
15961324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 23353620 - 23353659
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
23353620 |
atactagactttccacccgtgctgccgcacgggtcatata |
23353659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 6299019 - 6299057
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
6299019 |
tactagactttccacccgtgctgccgcacgggtcatata |
6299057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 995815 - 995852
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
995815 |
actagactttccacccgtgctgccgcacgggtcatata |
995852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 10478166 - 10478129
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
10478166 |
actagactttccacccgtgctgccgcacgggtcatata |
10478129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 18175610 - 18175573
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
18175610 |
actagactttccacccgtgctgccgcacgggtcatata |
18175573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 30473884 - 30473921
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
30473884 |
actagactttccacccgtgctgccgcacgggtcatata |
30473921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 32110861 - 32110898
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
32110861 |
actagactttccacccgtgctgccgcacgggtcatata |
32110898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 55
Target Start/End: Complemental strand, 11142691 - 11142659
Alignment:
| Q |
23 |
acttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
11142691 |
actttccacccgtgctgccgcacggatcatata |
11142659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 13)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 119
Target Start/End: Original strand, 1671836 - 1671936
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatatataattctaaacattacttacctcttttattaaaaactataggtgcgaaatataatccggtct |
117 |
Q |
| |
|
||||||||||| ||||||| || |||||| ||||||||| ||||||||||||| | | |||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
1671836 |
actagactttttacccgtgttgtcgcacgagtcatatatagttctaaacattacatgcactttttattaaaaa-tatagctgcgaaatatcatccggtct |
1671934 |
T |
 |
| Q |
118 |
tt |
119 |
Q |
| |
|
|| |
|
|
| T |
1671935 |
tt |
1671936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 8179752 - 8179792
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatatata |
57 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8179752 |
tactagactttccacccgtgctgccgcacggatcatatata |
8179792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 13 - 55
Target Start/End: Complemental strand, 20874922 - 20874880
Alignment:
| Q |
13 |
ataatactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
20874922 |
ataatactagactttccacccgtgctgccgcacgggtcatata |
20874880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 55
Target Start/End: Original strand, 20655045 - 20655086
Alignment:
| Q |
14 |
taatactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
20655045 |
taatactagactttccacccgtgctgccgcacgggtcatata |
20655086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 34110883 - 34110844
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
34110883 |
atactagactttccacccgtgctgccgcacgggtcatata |
34110844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 40177272 - 40177233
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
40177272 |
atactagactttccacccgtgctgccgcacgggtcatata |
40177233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 107
Target Start/End: Complemental strand, 3006719 - 3006629
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatatataattctaaacattacttacctcttttattaaaaactataggtgcgaaatat |
107 |
Q |
| |
|
|||||||||||||| |||| |||||||| | ||||||||| | | ||||||||| | | |||||||||||| ||||||||||| |||| |
|
|
| T |
3006719 |
tactagacttttcatccgtcttgccgcacaggtcatatatagtacaaaacattacctgcactttttattaaaaaatataggtgcgatatat |
3006629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 17373160 - 17373198
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
17373160 |
tactagactttccacccgtgctgccgcacgggtcatata |
17373198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 2398942 - 2398979
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
2398942 |
actagactttccacccgtgctgccgcacgggtcatata |
2398979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 10729442 - 10729479
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
10729442 |
actagactttccacccgtgctgccgcacgggtcatata |
10729479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 16526306 - 16526343
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
16526306 |
actagactttccacccgtgctgccgcacgggtcatata |
16526343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 34107338 - 34107375
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
34107338 |
actagactttccacccgtgctgccgcacgggtcatata |
34107375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 38246865 - 38246902
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
38246865 |
actagactttccacccgtgctgccgcacgggtcatata |
38246902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 12)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 25 - 99
Target Start/End: Complemental strand, 21981247 - 21981173
Alignment:
| Q |
25 |
ttttcacccgtgctgccgcacggatcatatataattctaaacattacttacctcttttattaaaaactataggtg |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||| ||| ||||||||| | | |||||||||||| |||||||| |
|
|
| T |
21981247 |
ttttcacccgtgctgccgcacgggtcatagatagttcaaaacattacctgcactttttattaaaaaatataggtg |
21981173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 13 - 55
Target Start/End: Complemental strand, 29942252 - 29942210
Alignment:
| Q |
13 |
ataatactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
29942252 |
ataatactagactttccacccgtgctgccgcacgggtcatata |
29942210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 4266612 - 4266573
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
4266612 |
atactagactttccacccgtgctgccgcacgggtcatata |
4266573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 21219660 - 21219695
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcata |
53 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21219660 |
actagactattcacccgtgctgccgcacggatcata |
21219695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 38913745 - 38913784
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
38913745 |
atactagactttccacccgtgctgccgcacgggtcatata |
38913784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 1232026 - 1231988
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
1232026 |
tactagactttccacccgtgctgccgcacgggtcatata |
1231988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 2951365 - 2951403
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
2951365 |
tactagactttccacccgtgctgccgcacgggtcatata |
2951403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 9216260 - 9216223
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
9216260 |
actagactttccacccgtgctgccgcacgggtcatata |
9216223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 18855233 - 18855270
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
18855233 |
actagactttccacccgtgctgccgcacgggtcatata |
18855270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 31018200 - 31018237
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
31018200 |
actagactttccacccgtgctgccgcacgggtcatata |
31018237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 34888686 - 34888723
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
34888686 |
actagactttccacccgtgctgccgcacgggtcatata |
34888723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 26497685 - 26497649
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatat |
54 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
26497685 |
actagactttgcacccgtgctgccgcacgggtcatat |
26497649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 12)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 40966456 - 40966404
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatatataattctaaacattac |
71 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
40966456 |
actagacttttcacc-gtgctgccgcacgggtcatatatagttcaaaacattac |
40966404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 13786401 - 13786362
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
13786401 |
atactagactttccacccgtgctgccgcacgggtcatata |
13786362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 57
Target Start/End: Original strand, 27903417 - 27903456
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatatata |
57 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
27903417 |
actagactttccacccgtgctgccgcacgggtcatatata |
27903456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 21342053 - 21342015
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
21342053 |
tactagactttccacccgtgctgccgcacgggtcatata |
21342015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 38163338 - 38163376
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
38163338 |
tactagactttccacccgtgctgccgcacgggtcatata |
38163376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 16376545 - 16376582
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
16376545 |
actagactttccacccgtgctgccgcacgggtcatata |
16376582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 21804572 - 21804609
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
21804572 |
actagactttccacccgtgctgccgcacgggtcatata |
21804609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 31373685 - 31373648
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
31373685 |
actagactttccacccgtgctgccgcacgggtcatata |
31373648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 33916947 - 33916984
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
33916947 |
actagactttccacccgtgctgccgcacgggtcatata |
33916984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 40969120 - 40969083
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
40969120 |
actagactttccacccgtgctgccgcacgggtcatata |
40969083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 42242154 - 42242191
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
42242154 |
actagactttccacccgtgctgccgcacgggtcatata |
42242191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 21670213 - 21670173
Alignment:
| Q |
15 |
aatactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||||| ||||||||||||||||| | ||||||| |
|
|
| T |
21670213 |
aatactagactttccacccgtgctgccgcacaggtcatata |
21670173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 10)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 4157747 - 4157804
Alignment:
| Q |
13 |
ataatactagacttttcacccgtgctgccgcacggatcatatataattctaaacatta |
70 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
4157747 |
ataaaactagacttttcacctgggctgccgcacgggtcatatatagttcaaaacatta |
4157804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 8539784 - 8539745
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
8539784 |
atactagactttccacccgtgctgccgcacgggtcatata |
8539745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 28099596 - 28099634
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
28099596 |
tactagactttccacccgtgctgccgcacgggtcatata |
28099634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 33646172 - 33646134
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
33646172 |
tactagactttccacccgtgctgccgcacgggtcatata |
33646134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 162669 - 162706
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
162669 |
actagactttccacccgtgctgccgcacgggtcatata |
162706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 2267005 - 2266968
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
2267005 |
actagactttccacccgtgctgccgcacgggtcatata |
2266968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 53
Target Start/End: Original strand, 2965457 - 2965494
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcata |
53 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
2965457 |
atactagacttatcacccgtgctgccgcacgggtcata |
2965494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 3593122 - 3593085
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
3593122 |
actagactttccacccgtgctgccgcacgggtcatata |
3593085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 12597265 - 12597302
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
12597265 |
actagactttccacccgtgctgccgcacgggtcatata |
12597302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 15044954 - 15044914
Alignment:
| Q |
15 |
aatactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||||| ||||||||||||||||| | ||||||| |
|
|
| T |
15044954 |
aatactagactttccacccgtgctgccgcacaggtcatata |
15044914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 15)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 26949030 - 26948990
Alignment:
| Q |
15 |
aatactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
26949030 |
aatactagactttccacccgtgctgccgcacgggtcatata |
26948990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 3898652 - 3898614
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
3898652 |
tactagactttccacccgtgctgccgcacgggtcatata |
3898614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 21098534 - 21098496
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
21098534 |
tactagactttccacccgtgctgccgcacgggtcatata |
21098496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 34121585 - 34121547
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
34121585 |
tactagactttccacccgtgctgccgcacgggtcatata |
34121547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 40014652 - 40014690
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
40014652 |
tactagactttccacccgtgctgccgcacgggtcatata |
40014690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 49672792 - 49672754
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
49672792 |
tactagactttccacccgtgctgccgcacgggtcatata |
49672754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 1941720 - 1941757
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
1941720 |
actagactttccacccgtgctgccgcacgggtcatata |
1941757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 4584434 - 4584471
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
4584434 |
actagactttccacccgtgctgccgcacgggtcatata |
4584471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 6460168 - 6460205
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
6460168 |
actagactttccacccgtgctgccgcacgggtcatata |
6460205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 12264429 - 12264392
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
12264429 |
actagactttccacccgtgctgccgcacgggtcatata |
12264392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 36076454 - 36076491
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
36076454 |
actagactttccacccgtgctgccgcacgggtcatata |
36076491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 38653927 - 38653964
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
38653927 |
actagactttccacccgtgctgccgcacgggtcatata |
38653964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 43363611 - 43363648
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
43363611 |
actagactttccacccgtgctgccgcacgggtcatata |
43363648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 54073259 - 54073222
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
54073259 |
actagactttccacccgtgctgccgcacgggtcatata |
54073222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 25437326 - 25437286
Alignment:
| Q |
14 |
taatactagacttttcacccgtgctgccgcacggatcatat |
54 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| |||||| |
|
|
| T |
25437326 |
taatactagaccttgcacccgtgctgccgcacgggtcatat |
25437286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 11)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 12090457 - 12090496
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
12090457 |
atactagactttccacccgtgctgccgcacgggtcatata |
12090496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 33139469 - 33139508
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
33139469 |
atactagactttccacccgtgctgccgcacgggtcatata |
33139508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 30824921 - 30824959
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
30824921 |
tactagactttccacccgtgctgccgcacgggtcatata |
30824959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 37651896 - 37651858
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
37651896 |
tactagactttccacccgtgctgccgcacgggtcatata |
37651858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 16904952 - 16904989
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
16904952 |
actagactttccacccgtgctgccgcacgggtcatata |
16904989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 18209740 - 18209703
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
18209740 |
actagactttccacccgtgctgccgcacgggtcatata |
18209703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 47
Target Start/End: Complemental strand, 26724173 - 26724144
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacgg |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26724173 |
actagacttttcacccgtgctgccgcacgg |
26724144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 31965969 - 31966006
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
31965969 |
actagactttccacccgtgctgccgcacgggtcatata |
31966006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 37590804 - 37590841
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
37590804 |
actagactttccacccgtgctgccgcacgggtcatata |
37590841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 52434853 - 52434816
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
52434853 |
actagactttccacccgtgctgccgcacgggtcatata |
52434816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 53143262 - 53143299
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
53143262 |
actagatttttcacccgtgctgccgcacgggtcatata |
53143299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 9)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 2988952 - 2988913
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
2988952 |
atactagacttttcacccgtgctgccgcatgggtcatata |
2988913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 41664741 - 41664702
Alignment:
| Q |
16 |
atactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
41664741 |
atactagactttccacccgtgctgccgcacgggtcatata |
41664702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 44902311 - 44902273
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
44902311 |
tactagactttccacccgtgctgccgcacgggtcatata |
44902273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 6120781 - 6120744
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
6120781 |
actagactttccacccgtgctgccgcacgggtcatata |
6120744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 8700490 - 8700453
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
8700490 |
actagactttccacccgtgctgccgcacgggtcatata |
8700453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 18351780 - 18351743
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
18351780 |
actagactttccacccgtgctgccgcacgggtcatata |
18351743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 19596363 - 19596400
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
19596363 |
actagactttccacccgtgctgccgcacgggtcatata |
19596400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 20545054 - 20545017
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
20545054 |
actagactttccacccgtgctgccgcacgggtcatata |
20545017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 27944796 - 27944833
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
27944796 |
actagactttccacccgtgctgccgcacgggtcatata |
27944833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 149049 - 149087
Alignment:
| Q |
17 |
tactagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
149049 |
tactagactttccacccgtgctgccgcacgggtcatata |
149087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 46503 - 46466
Alignment:
| Q |
18 |
actagacttttcacccgtgctgccgcacggatcatata |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
46503 |
actagactttccacccgtgctgccgcacgggtcatata |
46466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University