View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18714_low_23 (Length: 246)
Name: NF18714_low_23
Description: NF18714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18714_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 120 - 231
Target Start/End: Complemental strand, 53118664 - 53118547
Alignment:
| Q |
120 |
gaagggattttatgtttcctttattctttttcatttaataaataaca------tcacgcatcccgcataatcgagaaataaaatcatttcttacatagag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53118664 |
gaagggattttatgtttcctttattctttttcattctataaataataataatatcacgcatccctcataatcgagaaataaaatcatttcttacatagag |
53118565 |
T |
 |
| Q |
214 |
agtatggtaggacttaat |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
53118564 |
agtatggtaggacttaat |
53118547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 4730693 - 4730661
Alignment:
| Q |
11 |
gatgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
4730693 |
gatgaagtggggtcagagacctttttcaaacaa |
4730661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 24573854 - 24573822
Alignment:
| Q |
11 |
gatgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
24573854 |
gatgaagtggggccagggacctttttcaaacaa |
24573822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 28783932 - 28783900
Alignment:
| Q |
11 |
gatgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28783932 |
gatgaagtggggtcagggacctttttcaaacaa |
28783900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 19281850 - 19281822
Alignment:
| Q |
15 |
aagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19281850 |
aagtggggtcagggacctttttcaaacaa |
19281822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Complemental strand, 42093552 - 42093521
Alignment:
| Q |
12 |
atgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42093552 |
atgaagtggggtcagggacctttttcaaacaa |
42093521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Original strand, 32694705 - 32694736
Alignment:
| Q |
12 |
atgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32694705 |
atgaagtggggtcagggacctttttcaaacaa |
32694736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Original strand, 39084245 - 39084276
Alignment:
| Q |
12 |
atgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39084245 |
atgaagtggggtcagggacctttttcaaacaa |
39084276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Complemental strand, 40366385 - 40366354
Alignment:
| Q |
12 |
atgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40366385 |
atgaagtggggtcagggacctttttcaaacaa |
40366354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Original strand, 54281624 - 54281655
Alignment:
| Q |
12 |
atgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54281624 |
atgaagtggggtcagggacctttttcaaacaa |
54281655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 21102726 - 21102698
Alignment:
| Q |
15 |
aagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21102726 |
aagtggggtcagggacctttttcaaacaa |
21102698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Complemental strand, 30856220 - 30856189
Alignment:
| Q |
12 |
atgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30856220 |
atgaagtggggtcagggacctttttcaaacaa |
30856189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Complemental strand, 39840640 - 39840609
Alignment:
| Q |
12 |
atgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39840640 |
atgaagtggggtcagggacctttttcaaacaa |
39840609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 43
Target Start/End: Original strand, 41147210 - 41147241
Alignment:
| Q |
12 |
atgaagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41147210 |
atgaagtggggtcagggacctttttcaaacaa |
41147241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 8408115 - 8408087
Alignment:
| Q |
15 |
aagtggggtcagggacctttttcaaacaa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8408115 |
aagtggggtcagggacctttttcaaacaa |
8408087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University