View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18715_high_7 (Length: 293)
Name: NF18715_high_7
Description: NF18715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18715_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 270
Target Start/End: Complemental strand, 41367330 - 41367077
Alignment:
| Q |
13 |
aatatgcatattgctaattatctctgttctaagttcattttcacaacttggaacagcaatgctgaacttaactcttcctggaacacaccctgaccctgat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367330 |
aatatgcatattgctaattatctctgttctaagttcattttcacaacttggaacagcaatgctgaacttaactcttcctggaacacaccctgaccctgat |
41367231 |
T |
|
| Q |
113 |
gctgttgcccacgaagttcataggtgctctctcccttgtttctttcatctcaaatgtaccttcatacattgcattaatttagagaaaaatagcagatctg |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| || |||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
41367230 |
gctgttgcccacgaagttcataggtactctctcccttgtttcatt----tcaa-tgtaccttcatacattgtattaatttagaaaaaaatagcagatctg |
41367136 |
T |
|
| Q |
213 |
gacaccagtgccattttctactattttgttccttgtttt-cccatatttcagcttacta |
270 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
41367135 |
gacaccagtgtcattttccactatgttgtttcttgttttccccatatttcagcttacta |
41367077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University