View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18715_low_23 (Length: 219)
Name: NF18715_low_23
Description: NF18715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18715_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 37774879 - 37774692
Alignment:
| Q |
1 |
atgaaagataaaactgaaagaacgtagaaatggtgaaaataatgttgacattttcaaaagttatgaaaatgttatatatacttttaatattgtaagagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
37774879 |
atgaaagataaaactgaaagaacgtagaaatggtgaaaataatgttgacattttcaaaagttatgaaaatgttatatatacttttaaaattgtacgagaa |
37774780 |
T |
 |
| Q |
101 |
aatggtgaagatatattgaatctaccctctcttattttaggaaaatagttggcgtgaaaatgaaaacatgacaattttttaattaaaacgatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37774779 |
aatggtgaagatatattgaatctaccctctcttatttt-----aatagttgccgtgaaaatgaaaacatgacaattttttaattaaaacgatt |
37774692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University