View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18715_low_4 (Length: 463)
Name: NF18715_low_4
Description: NF18715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18715_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 2e-37; HSPs: 10)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 370 - 449
Target Start/End: Original strand, 6252464 - 6252543
Alignment:
| Q |
370 |
taacaaaatgacaaaagcgaagactttgtatagaagacttcaaatgaataacctctcaaaaatattcaaatgaatatggt |
449 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6252464 |
taacaaaatgacaaaagcgaagactttgtatagaagacttcaaatgaataacctctcaaaaatattcaaatgaatatggt |
6252543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 163 - 232
Target Start/End: Original strand, 6252002 - 6252071
Alignment:
| Q |
163 |
ctatcactagtattttctacatgtaaatggtcaattatgtatctttatggataattaaaattgttaattg |
232 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6252002 |
ctatccctagtattttctacatgtaaatggtcaattatgtatgtttatggataattaaaattgttaattg |
6252071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 374 - 430
Target Start/End: Original strand, 6186846 - 6186902
Alignment:
| Q |
374 |
aaaatgacaaaagcgaagactttgtatagaagacttcaaatgaataacctctcaaaa |
430 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6186846 |
aaaatgacaaaaccgaagactttgtatagaagacttcaaatgaataacctctcaaaa |
6186902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 374 - 430
Target Start/End: Original strand, 6193362 - 6193418
Alignment:
| Q |
374 |
aaaatgacaaaagcgaagactttgtatagaagacttcaaatgaataacctctcaaaa |
430 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6193362 |
aaaatgacaaaaccgaagactttgtatagaagacttcaaatgaataacctctcaaaa |
6193418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 374 - 430
Target Start/End: Original strand, 6203241 - 6203297
Alignment:
| Q |
374 |
aaaatgacaaaagcgaagactttgtatagaagacttcaaatgaataacctctcaaaa |
430 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6203241 |
aaaatgacaaaaccgaagactttgtatagaagacttcaaatgaataacctctcaaaa |
6203297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 5 - 76
Target Start/End: Original strand, 6251928 - 6251997
Alignment:
| Q |
5 |
acaaagatgaagtatgagaggctctcaacacgattgaattttaaagggagtgaacagccgtggacccacaaa |
76 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
6251928 |
acaaagatgaagtatgagaggctctcaac--gattggattttaaagggagtgagcagccgtggacccacaaa |
6251997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 169 - 257
Target Start/End: Original strand, 6186251 - 6186339
Alignment:
| Q |
169 |
ctagtattttctacatgtaaatggtcaattatgtatctttatggataattaaaattgttaattgttaattagattcatctatgtatctc |
257 |
Q |
| |
|
|||||||||| ||| |||| || ||||||||||||||| || || | |||||||||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
6186251 |
ctagtattttgaacacgtaattgttcaattatgtatcttcatagacagttaaaattgtaaattgttaattagattcatttatatatctc |
6186339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 169 - 257
Target Start/End: Original strand, 6192767 - 6192855
Alignment:
| Q |
169 |
ctagtattttctacatgtaaatggtcaattatgtatctttatggataattaaaattgttaattgttaattagattcatctatgtatctc |
257 |
Q |
| |
|
|||||||||| ||| |||| || ||||||||||||||| || || | |||||||||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
6192767 |
ctagtattttgaacacgtaattgttcaattatgtatcttcatagacagttaaaattgtaaattgttaattagattcatttatatatctc |
6192855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 77 - 108
Target Start/End: Original strand, 6186195 - 6186226
Alignment:
| Q |
77 |
agtttgatattcgtagaacttgcatatcacct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6186195 |
agtttgatattcgtagaacttgcatatcacct |
6186226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 77 - 108
Target Start/End: Original strand, 6192711 - 6192742
Alignment:
| Q |
77 |
agtttgatattcgtagaacttgcatatcacct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6192711 |
agtttgatattcgtagaacttgcatatcacct |
6192742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University