View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18716_high_14 (Length: 254)
Name: NF18716_high_14
Description: NF18716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18716_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 32087210 - 32087430
Alignment:
| Q |
1 |
ttcatatagagctttgctctagctttaaacagggtcctgcaagtggacgatgagattggtccattcgaattagttagttctttgatcg-ataccgaattt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
32087210 |
ttcatatagagctttgctctagctttaaacagactcctgcaagtggacgatgagattgatcaattcgaattagtcagttctttgatcggatactgaattt |
32087309 |
T |
 |
| Q |
100 |
tcgtnnnnnnnnnnnnnnnnnnnnncactttgtattcttatttatattcctactaaaatctcataaggaattttttatttatttagctgaataagaaaaa |
199 |
Q |
| |
|
|| | |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32087310 |
tcataaaaaaaaatataaaaaaaaacactttgtattcttatttatattcctactaaaatctcataagaaattttttatttatttagctgaataagaaaaa |
32087409 |
T |
 |
| Q |
200 |
gaaaacatttactttaaaata |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32087410 |
gaaaacatttactttaaaata |
32087430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 74
Target Start/End: Complemental strand, 39145739 - 39145679
Alignment:
| Q |
14 |
ttgctctagctttaaacagggtcctgcaagtggacgatgagattggtccattcgaattagt |
74 |
Q |
| |
|
||||||| ||||||||| || |||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
39145739 |
ttgctctggctttaaacgggcccctgcaagtggacggtgggattggtcccctcgaattagt |
39145679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 3 - 46
Target Start/End: Original strand, 10125918 - 10125961
Alignment:
| Q |
3 |
catatagagctttgctctagctttaaacagggtcctgcaagtgg |
46 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
10125918 |
catacagagctttgctctagctttaaacggggccctgcaagtgg |
10125961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 100
Target Start/End: Complemental strand, 13771574 - 13771482
Alignment:
| Q |
10 |
agctttgctctagctttaaacaggg-tcctgcaagtggacgatgagattggtccattcgaattagttagttctttgatc-gataccgaatttt |
100 |
Q |
| |
|
|||| |||||| ||||||||| ||| ||| ||||||||| |||||||||||||| | ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
13771574 |
agctatgctctggctttaaacggggctcccgcaagtggatgatgagattggtcccctataattagtcggttcttggatcggataccgaatttt |
13771482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 42485199 - 42485142
Alignment:
| Q |
1 |
ttcatatagagctttgctctagctttaaacagggtcc-tgcaagtggacgatgagatt |
57 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| || || ||||||||||||| |||||| |
|
|
| T |
42485199 |
ttcatacagagctttgctctggctttaaacaaggcccttgcaagtggacgacgagatt |
42485142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University