View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18716_high_16 (Length: 237)

Name: NF18716_high_16
Description: NF18716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18716_high_16
NF18716_high_16
[»] chr3 (4 HSPs)
chr3 (1-101)||(45169671-45169771)
chr3 (143-223)||(45172802-45172882)
chr3 (143-214)||(13218089-13218165)
chr3 (143-176)||(54180969-54181002)


Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 45169671 - 45169771
Alignment:
1 gtatcatctctccctcgatggaccccaatcatttgcagttggtttatcgtgtagcagcaggaaggaaccgttccatttatagggataaattttctctttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
45169671 gtatcatctctccctcgatggaccccaatcatttgcagttggtttatggtgtagcagcaggaaggaaccgttccatttatagggataaattttctctttc 45169770  T
101 a 101  Q
    |    
45169771 a 45169771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 143 - 223
Target Start/End: Original strand, 45172802 - 45172882
Alignment:
143 gaccatatgcagattatgaggaaccataagactgctcgtgatgcctgctcccataagaaatcacggagccacttgttaatg 223  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
45172802 gaccatatgcagattatgaggaaccataagactgctcgggatgcctgctcccataagaaatcacggagccacttgttaatg 45172882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 143 - 214
Target Start/End: Complemental strand, 13218165 - 13218089
Alignment:
143 gaccatatgcagattatgaggaaccataagactg-----ctcgtgatgcctgctcccataagaaatcacggagccac 214  Q
    |||||||||||||| |||||||||||||||||||     |  | ||||||||| ||||||||||||| |||||||||    
13218165 gaccatatgcagataatgaggaaccataagactgaattacctgggatgcctgcgcccataagaaatcgcggagccac 13218089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 176
Target Start/End: Original strand, 54180969 - 54181002
Alignment:
143 gaccatatgcagattatgaggaaccataagactg 176  Q
    |||||||||||||| |||||||||||||||||||    
54180969 gaccatatgcagataatgaggaaccataagactg 54181002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University